Posted by on 4 grudnia 2018

Krew pobrano od wszystkich 10 osób po uzyskaniu świadomej zgody. Kryteria rozpoznania zespołu Gilberta obejmowały stałe łagodne zwiększenie stężenia bilirubiny w surowicy (poziom od 1,2 do 5,3 mg na decylitr [20 do 90 .mol na litr]). Bilirubina była w co najmniej 90% nieskoniugowana zgodnie z testem van den Bergha, a 99% nieskoniugowana na podstawie wysokosprawnej chromatografii cieczowej. Wartości aminotransferazy alaninowej w surowicy i aminotransferazy asparaginianowej były prawidłowe. Hemolizę wykluczono na podstawie prawidłowych wartości hemoglobiny i haptoglobiny oraz liczby retikulocytów. Trzech pacjentów otrzymywało dietę 400 kcal przez 24 godziny, co podwoiło poziom bilirubiny w surowicy. U dwóch pacjentów wykonano aspirację dwunastniczą do analizy żółci i pigmentu za pomocą wysokosprawnej chromatografii cieczowej32; w obu monoglukuronid stanowił 30 procent koniugatów bilirubiny.33 Pacjenci z zespołu Spokrewnionego z Criglerem-Najjarem Typ II
Zbadaliśmy 2 pacjentów z zespołem Criglera-Najjara typu II, 10 heterozygotycznych nosicieli i 4 członków rodziny, którzy nie byli nosicielami od krewnych z historią zespołu. Obydwaj pacjenci byli homozygotyczni pod względem mutacji strukturalnej, która znacząco zmniejszała katalityczną aktywność bilirubiny UDP-glukuronosylotransferazy.22,24 Czterech z 10 heterozygotycznych nosicieli miało łagodną hiperbilirubinemię. Wszyscy wyrazili świadomą zgodę.
Obiekty kontrolne
Przebadaliśmy 55 osób zdrowych (28 kobiet i 27 mężczyzn w wieku od 21 do 55 lat) bez znanej żółtaczki. Wszyscy wyrazili świadomą zgodę. Stężenie bilirubiny w surowicy mierzono w próbkach pobranych w dwa różne dni.34 W naszym laboratorium górna granica normy dla bilirubiny w surowicy wynosi 1,0 mg na decylitr (17,1 .mol na litr). W przypadku próbek o stężeniu bilirubiny w surowicy wynoszącym 0,9 mg na decylitr (15,4 mola na litr), mniej niż 5 procent zmian występuje pomiędzy próbkami pobranymi w dwóch różnych dniach.
Sekwencjonowanie nukleotydowe regionów kodujących i położonych w górę genu bilirubiny UDP-glukuronosylotransferazy
Genomowy DNA wyizolowano z limfocytów i pięciu eksonów tworzących region kodujący genu bilirubiny UDP-glukuronosylotransferazy 1, a ich flankujące połączenia intron-ekson amplifikowano przez łańcuchową reakcję polimerazy (PCR) i sekwencjonowano jak opisano 15. DNA 5 do regionu kodującego (od nukleotydu -227 do nukleotydu 132) amplifikowano za pomocą sensownego primera, 5 GAGGTTCTGGAAGTACTTTGC3 i antysensownego primera, 5 CCAAGCATGCTCAGCCAG3 . Przeprowadzono PCR przez 30 cykli polegających na denaturacji w 95 ° C przez 30 sekund, hybrydyzacji w 56 ° C przez 30 sekund i wydłużeniu w 72 ° C przez 30 sekund, przy czym 1,5 mmola chlorku magnezu na litr użyto jako bufor. Obie nici amplifikowanego segmentu sekwencjonowano dwoma wewnętrznymi starterami.
Funkcjonalna ocena wariantowego elementu Tataa
Fragment górnego regionu (od nukleotydu -546 do nukleotydu -4) genu bilirubiny UDP-glukuronozylotransferazy zamplifikowano za pomocą PCR z genomowym DNA od osobnika homozygotycznego pod kątem długiego elementu TATAA, A (TA) 7TAA i od przedmiot homozygotyczny dla normalnego elementu TATAA, A (TA) 6TAA. Amplimery zaprojektowano tak, aby wprowadzić miejsce XhoI i Hindlll na 5 i 3 końcu amplikonu (amplifikowany produkt), odpowiednio.
[patrz też: ośrodki odwykowe nfz, szyna gipsowa, lek bez recepty na grzybicę pochwy ]

Powiązane tematy z artykułem: lek bez recepty na grzybicę pochwy ośrodki odwykowe nfz szyna gipsowa

Posted by on 4 grudnia 2018

Krew pobrano od wszystkich 10 osób po uzyskaniu świadomej zgody. Kryteria rozpoznania zespołu Gilberta obejmowały stałe łagodne zwiększenie stężenia bilirubiny w surowicy (poziom od 1,2 do 5,3 mg na decylitr [20 do 90 .mol na litr]). Bilirubina była w co najmniej 90% nieskoniugowana zgodnie z testem van den Bergha, a 99% nieskoniugowana na podstawie wysokosprawnej chromatografii cieczowej. Wartości aminotransferazy alaninowej w surowicy i aminotransferazy asparaginianowej były prawidłowe. Hemolizę wykluczono na podstawie prawidłowych wartości hemoglobiny i haptoglobiny oraz liczby retikulocytów. Trzech pacjentów otrzymywało dietę 400 kcal przez 24 godziny, co podwoiło poziom bilirubiny w surowicy. U dwóch pacjentów wykonano aspirację dwunastniczą do analizy żółci i pigmentu za pomocą wysokosprawnej chromatografii cieczowej32; w obu monoglukuronid stanowił 30 procent koniugatów bilirubiny.33 Pacjenci z zespołu Spokrewnionego z Criglerem-Najjarem Typ II
Zbadaliśmy 2 pacjentów z zespołem Criglera-Najjara typu II, 10 heterozygotycznych nosicieli i 4 członków rodziny, którzy nie byli nosicielami od krewnych z historią zespołu. Obydwaj pacjenci byli homozygotyczni pod względem mutacji strukturalnej, która znacząco zmniejszała katalityczną aktywność bilirubiny UDP-glukuronosylotransferazy.22,24 Czterech z 10 heterozygotycznych nosicieli miało łagodną hiperbilirubinemię. Wszyscy wyrazili świadomą zgodę.
Obiekty kontrolne
Przebadaliśmy 55 osób zdrowych (28 kobiet i 27 mężczyzn w wieku od 21 do 55 lat) bez znanej żółtaczki. Wszyscy wyrazili świadomą zgodę. Stężenie bilirubiny w surowicy mierzono w próbkach pobranych w dwa różne dni.34 W naszym laboratorium górna granica normy dla bilirubiny w surowicy wynosi 1,0 mg na decylitr (17,1 .mol na litr). W przypadku próbek o stężeniu bilirubiny w surowicy wynoszącym 0,9 mg na decylitr (15,4 mola na litr), mniej niż 5 procent zmian występuje pomiędzy próbkami pobranymi w dwóch różnych dniach.
Sekwencjonowanie nukleotydowe regionów kodujących i położonych w górę genu bilirubiny UDP-glukuronosylotransferazy
Genomowy DNA wyizolowano z limfocytów i pięciu eksonów tworzących region kodujący genu bilirubiny UDP-glukuronosylotransferazy 1, a ich flankujące połączenia intron-ekson amplifikowano przez łańcuchową reakcję polimerazy (PCR) i sekwencjonowano jak opisano 15. DNA 5 do regionu kodującego (od nukleotydu -227 do nukleotydu 132) amplifikowano za pomocą sensownego primera, 5 GAGGTTCTGGAAGTACTTTGC3 i antysensownego primera, 5 CCAAGCATGCTCAGCCAG3 . Przeprowadzono PCR przez 30 cykli polegających na denaturacji w 95 ° C przez 30 sekund, hybrydyzacji w 56 ° C przez 30 sekund i wydłużeniu w 72 ° C przez 30 sekund, przy czym 1,5 mmola chlorku magnezu na litr użyto jako bufor. Obie nici amplifikowanego segmentu sekwencjonowano dwoma wewnętrznymi starterami.
Funkcjonalna ocena wariantowego elementu Tataa
Fragment górnego regionu (od nukleotydu -546 do nukleotydu -4) genu bilirubiny UDP-glukuronozylotransferazy zamplifikowano za pomocą PCR z genomowym DNA od osobnika homozygotycznego pod kątem długiego elementu TATAA, A (TA) 7TAA i od przedmiot homozygotyczny dla normalnego elementu TATAA, A (TA) 6TAA. Amplimery zaprojektowano tak, aby wprowadzić miejsce XhoI i Hindlll na 5 i 3 końcu amplikonu (amplifikowany produkt), odpowiednio.
[patrz też: ośrodki odwykowe nfz, szyna gipsowa, lek bez recepty na grzybicę pochwy ]

Powiązane tematy z artykułem: lek bez recepty na grzybicę pochwy ośrodki odwykowe nfz szyna gipsowa